|
|
|
This experiment consists of two more or less parallel subexperiments, A and B.
1. (A) Transformation of wild-type Synechocystis with the pKCP43 plasmid; plate cells on agar w/antibiotic.
2. (B) PCR amplification of the wild-type Synechocystis psbC gene.
1. (A) Observe Synechocystis transformation plate.
1. (A) Segregation of Synechocystis transformants: Transfer to a new plate with higher antibiotic concentration.
2. (B) Gel electrophoresis of PCR products.
Week 5
1. B) Purification of PCR product.1. A) Continue segregation for Synechocystis transformants with higher antibiotic.
2. B) Restriction digestion of the psbC PCR product and pUC19 plasmid.1. B) Start a plate of wild-type Synechocystis sp. PCC 6803.
2. B) Ligate digests of psbC and pUC19.1. A) Continue segregation for Synechocystis transformants with higher antibiotic.
2. B) Transform E. coli with ligation mix; plate cells.1. B) Prepare recombinant plasmid; submit for sequencing.
1. (A) Continue segregation for Synechocystis transformants by transferring to agar plates with higher antibiotic concentration.
2. B) Gel electrophoresis of recombinant plasmid.1. A) Small scale DNA preparation from wild-type and the psbC- mutant of Synechocystis.
1. A/B) Transform psbC-Synechocystis with recombinant plasmid and wild-type DNA.
2. A) PCR of DNA from wild type and the psbC- transformant of Synechocystis.
1. A) Analysis of PCR products by gel electrophoresis.
2. A/B) Check plates for restored photoautotrophic phenotype by transformation of psbC- mutant.
E. coli is not the sole bacterium that is amenable to molecular biology. There are many such bacteria. In this lab, one of these, the cyanobacterium Synechocystis sp. PCC6803 is introduced. This cyanobacterium has several advantages that make it a very useful organism for gene manipulations. The two main advantages are:
1. Natural transformability. In contrast to E. coli and most other bacteria, it spontaneously takes up foreign DNA that is present in the growth medium, and can integrate it into its genome through a double homologous recombination event. Double homologous recombination is appropriate to introduce gene interruptions or deletions using a construct with two regions of sequence identity with the cyanobacterial genome.
2. The ability to grow in many different conditions. It can grow photoautotrophically utilizing its photosynthetic system to produce sugars from CO2 and water, using light for energy. It also can grow photoheterotrophically utilizing a reduced carbon source in the growth medium. This characteristic helps Synechocystis survive under different growth conditions, and cope with a mutation in its photosynthetic system.
As most prokaryotes, Synechocystis has a double-stranded circular genome. However, in contrast to many other prokaryotes, it carries multiple (6-12) copies of the genome in a single cell. As upon transformation only a single genome copy in the cell may be altered, wild-type and mutant genomes are slowly sorted out (segregated) upon repeated cell divisions. A Synechocystis mutant means that all genome copies carry the same mutation, and that the wild-type genome copies are absent. Segregation of mutants is achieved through a steep increase in the antibiotic concentration in the growth medium. Cells that carry the mutation in every copy of the genome are at a selective advantage to cope with high concentrations of the antibiotic.
The doubling time of Synechocystis is 12 hours (versus 20 minutes for E. coli), and it takes 7-10 days to get visible colonies of transformants on a plate.
This experiment consists of two parallel and eventually converging parts, which are distinguished in the experiment outline by the letters "A" and "B". Part "A" of the experiment starts by introducing a mutation in the psbC gene of wild-type Synechocystis. This gene codes for an intrinsic chlorophyll-binding protein CP43 that is essential in the assembly and function of photosystem II (Figure 1).

The mutation is introduced by interrupting the psbC gene by a kanamycin resistance gene via double-homologous recombination with the pKCP43 plasmid. This plasmid contains part of the psbC gene interrupted by a kanamycin resistance gene (Figure 2).

Figure 2. Interruption of the psbC gene by homologous double recombination. Segregation will be confirmed by PCR.
The kanamycin-resistant phenotype of the Synechocystis psbC- mutant will be used for segregation. Complete segregation will be confirmed by performing PCR using primers upstream and downstream of the interrupted part of the psbC gene. After segregation, cells no longer have an active photosystem II complex and depend on sugar addition for their survival.
In part "B" of the experiment, part of the wild-type psbC gene will be amplified and will be cloned in a plasmid. The recombinant plasmid is amplified in E. coli, sequenced, and used to transform the mutant psbC- strain to revert it to wild type and to restore its ability to grow photoautotrophically.| Sterile 1.5 ml microcentrifuge tubes | Microfuge |
| P200 and P20 pipettors | Sterile pipet tips |
| Synechocystis sp. PCC 6803 cell culture | pKCP43 plasmid |
| BG - 11 agar plates +/- kanamycin | Sterile nylon filters |
| BG - 11+glucose medium |
BG - 11 contains primarily salts and minerals. It does not contain glucose, as cyanobacteria can make their own sugars using photosynthesis.
BG - 11 LIQUID MEDIA
| For l liter: | |
| 10 ml | 100 x BG - 11 without Fe, phosphate, carbonate |
| 1 ml | 1000 x Ferric ammonium citrate |
| 1 ml | 1000 x Na2CO3 |
| 1 ml | 1000 x K2HPO4 |
| Fill to 1 L and store at 4 °C. |
BG - 11 AGAR PLATES
Add to the above:
| 10 ml | 1 M TES/NaOH buffer pH 8.2 | |
| 3 g | Na-thiosulfate | |
| 15 g | Difco Bacto-agar (no substitutions, please) | |
| Autoclave for 30 min. | ||
| 100 x BG - 11 without Fe, phosphate, carbonate | ||
| 1 liter | ||
| 149.60 g | NaNO3 | |
| 7.49 g | MgSO4 . 7 H2O | |
| 3.60 g | CaCl2 . 2 H2O | |
| 0.60 g | Citric acid (or 0.89 g Na-citrate, dihydrate) | |
| 1.12 ml | NaEDTA, pH 8.0, 0.25 M | |
| 100 ml | Trace Minerals |
Trace Minerals
| For 1 liter | ||
| 2.86 g | H3BO3 | |
| 1.81 g | MnCl2 . 4 H2O | |
| 0.222 g | ZnSO4 . 7 H2O | |
| 0.39 g | Na2MoO4 . 2H2O | |
| 0.079 g | CuSO4 . 5 H2O | |
| 0.0494 g | Co(NO3)2 . 6 H2O |
Other Components
| Ferric ammonium citrate, 6 mg/ml (1000 x) | |
| 600 mg per 100 ml H2O | |
| Na2CO3, (1000 x) | |
| 2 g Na2CO3 per 100 ml H2O | |
| K2HPO4, (1000 x) | |
| 3.05 g K2HPO4 per 100 ml H2O |
If addition of glucose or kanamycin to BG - 11 agar medium is required:
1) Cool autoclaved BG - 11 agar medium to 55 °C in waterbath.
2) Add filter-sterilized solutions of glucose or kanamycin.
| Final concentrations: | ||
| glucose | 5 mM | |
| kanamycin | 25 µg/ml |
3) Pour plates: 50 ml per plate (thicker than for E. coli, as it will take
much longer for colonies to appear).
Work in sterile conditions! Many prokaryotes grow faster than Synechocystis, so contamination is a real problem, particularly if glucose is present!
1. (prepared by the TA) Grow Synechocystis on BG - 11+ glucose medium to OD730 = 0.5. (OD730 is the optical density at 730 nm, which is in the infrared region of the spectrum where very little absorbs. The optical density is not absorption, but rather scattering of light by cells. This is a good measure of the cell density.)
2. (prepared by the TA) Sterilely transfer 1.5 ml of culture to a sterile microcentrifuge tube.
3. Spin cells at 7000 rpm for 2 minutes in a balanced microcentrifuge.
4. Remove the supernatant by pipetting.
5. Add 200 µl of fresh BG - 11 medium to the cells and resuspend cells by pipetting in and out.
6. Add 2 µl of the pKCP43 plasmid and shake the tube several times.
7. Incubate at room temperature for 30 minutes.
8. Place a sterile filter on top of an agar plate that contains BG - 11 + 5 mM glucose. Plate the cell suspension on the filter, spread it, and let it dry. The plate will be incubated in the light at 30 °C. The TA will transfer the filter the next day to a BG - 11/glucose plate that contains 5 µg/ml kanamycin.
9. In week 4, you will transfer a single colony from this plate to a fresh agar plate that contains a higher concentration of kanamycin.
Polymerase Chain Reaction (PCR)
Polymerase chain reaction (PCR) enables the amplification of any DNA sequence (producing millions or even billions of copies) in just a few hours. An important feature of PCR is that the DNA segment chosen to be amplified does not need to be separated from the rest of the genomic DNA prior to initiating the amplification procedure. However, once amplified, the segment can readily be separated from the bulk of DNA (which is not amplified) by gel electrophoresis.
Amplification of part of the wild-type psbC
Numbering of the psbC locus starts at 1 and terminates at 1418. In the PCR reaction today you will amplify the sequence between 662 and 2819: this means that you will amplify the 3' end of the gene and the adjacent (flanking) region.
PCR requires buffer, primers, and nucleotides (dNTPs). Keep dNTP on ice at all times. After adding dNTP to your sample, place samples on ice. Wear gloves when handling the reagents to eliminate the possibility of contaminating your samples by proteases, DNase, or an alternate template.
Materials: PCR
0.2 ml PCR tubes
P20, P200, and pipet tips
Disposable gloves
DNA thermal cycler
8 pmol/µl CP1 forward primer (662)
5' GTTGGATCATCAGTGTCAACAACATGG 3'
8 pmol/µl CP2 reverse primer (2819)
5' GCTACCTAAACAGAGTATCTAACG 3'
10x PCR Buffer
Taq Polymerase
ddH2O
Synechocystis genomic DNA
1 mM dNTPs
Ice
Inoculating loop
BG - 11+glucose+kanamycin (20 µg/ml) agar plates
Tape
Method: PCR Amplification of Part of the Wild-Type psbC Gene
1. Add the reagents in the order listed below:
| Reagent | Volume, µl |
| 1. ddH2O | 27.5 |
| 2. PCR Buffer | 5 |
| 3. CP1 | 2.5 |
| 4. CP2 | 2.5 |
| 5. dNTP | 10 |
| 6. Genomic DNA | 2 |
| Mix | |
| 7. Taq Polymerase | 0.5 |
| Total volume | 50 |
2. Mix the sample by pipetting the full volume in and out.
3. Place your sample in the Thermal Cycler and set to the following parameters:
1. 94 °C for 3 minutes
2. 94 °C for 1 minute
3. 58 °C for 1 minute
4. 72 °C for 1 minute
Repeat steps 2-4 30 cycles
5. 4 °C soak cycle
4. The TA will remove samples from the PCR machine, and put them at -20°C.
Prelab Questions1. Discuss why Synechocystis does not require electroporation or chemical pretreatment prior to transformation.
2. What specific genetic manipulation does Synechocystis readily allow that E. coli does not?
3. Discuss the procedure for isolation of Synechocystis transformants. Why do you first plate your transformant mixture on a filter on a BG - 11 plate with glucose, and the next day the TA transfers the filter with cells to a plate that contains kanamycin? Would it not be much more convenient if you directly plated your cells on a kanamycin-containing plate?
4. Discuss the procedure for segregation of Synechocystis mutants.
5. What is the product of the psbC gene? What is its function?
6. Compare the use of E. coli as a plasmid DNA copy machine versus the use of PCR.
7. What is the role of each of the PCR reagents, i.e., primers, dNTP, Mg2+, and Taq polymerase?
8. What are the considerations in determining the number of cycles needed for the PCR reaction?
Weekly Report Update
1. Discuss the use of the pKCP43 plasmid for mutation of the psbC gene.
2. Discuss the use of PCR for amplification of part of psbC gene.
Record your observations regarding the Synechocystis transformant plates.
Segregation of Mutant Synechocystis Transformants by Transferring to Higher Antibiotic Concentration
Work in sterile conditions
1. Label the bottom of a BG - 11+ glucose+ kanamycin (20 µg/ml) plate.
2. Sterilize the inoculation loop by flaming it in the burner flame until it glows red, and then passing the entire wire through the flame.
3. Cool the loop by dipping it into the agar of the fresh plate (lift the lid of this plate not more than necessary, and do not touch the plate or the lid with the loop or the handle of the inoculation loop); do not set the inoculation loop on the bench. Close the plate.
4. Remove the lid from the culture plate prepared in lab 3 and place it right-side up next to the culture plate.
5. Using the loop tip, scrape up a single colony being careful not to gouge the filter or agar. Close the plate.
6. Open the BG - 11+ glucose+ kanamycin (20 µg/ml) plate just enough to streak the top surface of the agar by gliding the loop back and forth several times to cover a quarter of the plate (Figure 3, hand out).
7. Replace the lid and sterilize the loop again by repeating steps 2-3.
8. Carefully open the freshly streaked plate, and starting from the edge of the first streak, make a zigzag streak across the second quarter of the plate.
9. Sterilize and cool the loop again and make a second zigzag starting from the edge of the first zigzag covering the third plate quarter.
10. Sterilize and cool the loop again and make a third zigzag starting from the edge of the second zigzag covering the forth plate quarter.
11. Put on the lid and incubate the plate at 30°C in the light.
Gel electrophoresis of PCR product
Materials
PCR samples from previous lab period
Agarose gel with ethidium bromide (prepared by TA)
6X Loading dye
Electrophoresis box, tray and comb
1 kb DNA marker
TAE buffer
Microcentrifuge
1.5 ml Microcentrifuge tubes
P20, P200, and tips
1 mg/ml ethidium bromide solution
Gel Electrophoresis on PCR Product
NOTE: You will also be running samples from Experiment I at the same time. They can be run on the same or different gels.
1. Place 2 µl of loading dye on a small piece of parafilm and add 10 µl of the PCR product. Mix by pipetting the full volume of sample (12 µl) in and out.
2. Load the PCR sample in a well, and load 4 µl of the 1 kb DNA ladder in a separate well next to your sample(s).
3. Run the gel for 40-50 minutes at 70 volts.
4. Carefully remove your gel from the gel electrophoresis box into a container for safe transport of ethidium bromide-containing material to the AlphaImager.
5. View with a UV source (AlphaImager) and photograph your gel.
Prelab Questions
1. What size fragment do you expect the PCR product to be?
2. Why is it necessary to analyze the PCR product by gel electrophoresis?
Weekly Report Update
1. Present the result of gel electrophoresis. Include your gel photograph.
Purification of the PCR Product
You will use a commercial kit, QIAquick PCR Purification Kit (http://www1.qiagen.com/Products/DnaCleanup/GelPcrSiCleanupSystems/QIAquickPCRPurificationKit.aspx?rp=1000254&rpg=0). You can obtain the product protocol as a pdf file “QIAquick_Spin_Handbook.pdf” on the Blackboard site. The process works via binding of DNA to silica at high ionic strength, and release at low ionic strength (Fig. 3). Addition of chaotropic salt drives binding of DNA via the negatively charged phosphate groups, via salt bridge.

In this kit, the silica is on the surface of a membrane that is contained in a spin column cartridge, which fits into a microcentrifuge tube for convenient operation. The solution containing the DNA fragment is run through the membrane, which is then washed, and finally the DNA is eluted with low salt buffer.

Materials
PCR reactions from week 2
QIAquick Buffer PBI (binding)
QIAquick Buffer PE (wash)
QIAquick Buffer EB (elution)
QIAquick spin columns
QIAquick 2 ml collection tubes
Ethanol (96–100%)
3 M sodium acetate, pH 5.0
P-20 and P-200 pipettors and tips
1.5 ml microcentrifuge tubes
Microcentrifuge
Method
1. Add 5 volumes of Buffer PBI to 1 volume of the PCR sample and mix. Thus, to your remaining 40 µl of PCR reaction (after removal of 10 µl for electrophoresis in Week 4), add 200 µl of Buffer PBI.
2. Check that the color of the mixture is yellow (similar to Buffer PBI without
the PCR
sample).
If the color of the mixture is orange or violet, add 10 µl of 3 M sodium
acetate, pH
5.0, and mix. The color of the mixture will turn to yellow.
3. Place a QIAquick spin column in a provided 2 ml collection tube.
4. To bind DNA, apply the sample to the QIAquick column and centrifuge at full speed for 30–60 sec.
5. Discard flow-through. Place the QIAquick column back into the same tube.
6. To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 sec.
7. Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
IMPORTANT: Residual ethanol from Buffer PE will not be completely removed
unless the flow-through is discarded before this additional centrifugation.
8. Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
9. To elute DNA, add 30 µl Buffer EB (10 mM Tris·Cl, pH 8.5)
to the center of the QIAquick membrane, let the column stand for 1 min, and
centrifuge the column for 1 min.
IMPORTANT: Ensure that the elution buffer is dispensed directly onto the
QIAquick membrane for complete elution of bound DNA. The average eluate volume
is 48 µl from 50 µl elution buffer volume, and 28 µl from 30 µl
elution buffer.
Elution efficiency is dependent on pH. The maximum elution efficiency is achieved
between pH 7.0 and 8.5.
Prelab Questions
1. What is the purpose of the PCR product purification?
3. What is the mechanism of DNA binding to silica?
In this lab period, you will do the following:
(A) Continued segregation of the Synechocystis transformants by transfer to higher concentrations of kanamycin.
(B) Restriction digest your psbC PCR product, for later cloning of part of the psbC gene in the pUC19 plasmid.
The plasmid pUC19 (Figure 4) offers the following advantages:
1. It has a high copy number, which means that "hundreds" of pUC19 plasmids can be accommodated in a single cell. This is an important characteristic especially when considering amplification and isolation of the plasmid.
2. The plasmid has a stretch of 50 nucleotides that contain several different restriction sites. This stretch is also referred to as polylinker.
3. “Blue-white” screening for recombinants. The polylinker sequence overlaps with the lacZ gene. The lacZ gene codes for a protein (beta-galactosidase) that catabolizes lactose. If a DNA fragment is cloned within the polylinker it inactivates lacZ , and the cells carrying such plasmid are no longer able to catabolize lactose. A synthetic analog of lactose, X-gal, is added to plates with the transformants to distinguish cells that carry the intact plasmid from those with the recombinant plasmid. Cells with the intact pUC19 can catabolize X-gal generating blue colored colonies, while cells containing the recombinant plasmid remain white.

Figure 4. pUC19 Plasmid
In this experiment you will perform two separate restriction digestions. The pUC19 plasmid (Fig. 4) will be restricted with HindIII and SmaI, and the PCR product will be restricted with ScaI and HindIII. Cloning of the PCR fragment into pUC19 is achieved through the ligation of fragments with the sticky-end cuts of HindIII on one end, and blunt-end cuts of ScaI and SmaI on the other end.
Materials
PCR product purified in week 5
pUC19 plasmid
NEB buffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate,
1 mM dithiothreitol)
NEBbuffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1mM dithiothreitol)
NEB buffer 3 (50 mM Tris-HCl, 100 mM NaCl, 10 mM MgCl2, 1 mM dithiothreitol)
Ligase buffer (50 mM Tris-HCl, 10 mM magnesium chloride, 10 mM dithiothreitol,
1 mM ATP, 1 mg/ml bovine serum albumin)
Hind III, Sma I and Sca I restriction enzymes
ddH2O
Ice
Disposable gloves
P20, P200 and pipet tips
BG - 11+glucose+kanamycin (50 µg/ml)
Ligase enzyme 20 units/µl
Method
Restriction digestion of PCR product and plasmid
1. Review enzyme handling procedures (lab 1).
2. Vector plasmid digest: Into a 0.5 ml microcentrifuge tube, add the following reagents in the order given:
| Reagent | Volume (µl) |
| 1. ddH2O | 15 |
| 2. NEB buffer 4 | 2 |
| Mix | 2 |
| 3. pUC19 plasmid | 2 (0.5 µg) |
| 4.SmaI | 1 |
| Mix | |
| Total volume | 20 |
3. Mix the sample by pipetting the total volume in and out.
4. Incubate at room temperature (~25 °C) for 1 hour.
5. To the reaction from step #4, add 1 µl HindIII, mix the sample by pipetting the total volume in and out 3 times, and incubate 37 °C for 1 hour.
6. PCR product digest: Into a 0.5 ml microcentrifuge tube, add the following reagents in the order given:
| Reagent | Volume (µl) |
| 1. ddH2O | 2 |
| 2. NEB buffer 2 | 2 |
| Mix | |
| 3. PCR product | 15 |
| 4. Hind III | 1 |
| Mix | |
| Total volume | 20 |
7. Mix the sample by pipetting the total volume in and out, and incubate at 37 °C for 1 hour..
8. To the reaction from step #7, add 1 µl NEB buffer 3 and 1 µl ScaI, mix the sample by pipetting the total volume in and out 3 times, and incubate 37 °C for 1 hour.
9. Inactivate the restriction enzymes in the two restriction digestion reaction mixes by incubating in a 70 °C water bath for 20 min.
10. Store the samples at -20 °C until next week.
Segregation of Synechocystis transformants: Transfer to higher concentrations of kanamycin
1. Transfer one colony from the plate prepared in week 4 to a BG - 11+glucose+kanamycin (50 µg/ml) plate following the same procedure outlined in week 5.
Prelab Questions
1. Explain the reason for the use of the enzymes in the two digests consulting pUC19 and psbC gene restriction maps.
Weekly Report Update
1. Looking forward at what will be done in later weeks, what is the purpose of constructing the recombinant plasmid?
Materials
Restriction digests from Week 6
Ligase buffer (50 mM Tris-HCl, 10 mM magnesium chloride, 10 mM dithiothreitol,
1 mM ATP, 1 mg/ml bovine serum albumin)
ddH2O
Ice
Disposable gloves
P20, P200 and pipet tips
Ligase enzyme 400 units/µl
Glycogen (20 mg/ml)
7.5 M ammonium acetate
isopropanol (2-propanol)
Ligation of digests of psbC and pUC19
1. (prepared by TA) The ligation mix was prepared just prior to the lab period as follows:
| Reagent | volume (µl) |
| 1. dd H2O | 7 |
| 2. Ligase buffer (10X) | 2 |
| 3. Ligase enzyme | 1 |
| Total volume | 10 |
2. Ligate the two restriction digestion fragments by adding the following reagents to the ligation reaction mix:
| 1. pUC19 digestion mix | 5 |
| 2. PCR digestion mix | 5 |
3. Mix the sample by carefully pipetting half of the volume in and out several times. Avoid bubbles; if you do generate bubbles, microfuge the sample 5 seconds.
4. Incubate tubes at room temperature for 2 hours, or until 10 min before the end of lab period.
5. Precipitate the ligated DNA. To the ligation mix add:
| 10 µl | 7.5M ammonium acetate |
| 1 µl | 20 mg/ml glycogen (carrier to enhance recovery of dilute DNA) |
| 42 µl | isopropanol |
6. Mix well by flicking the tube with your finger several times, store at 4 °C until next week.
Starting A Plate of Wild-Type Synechocystis
2. Transfer a single colony from wild-type Synechocystis plate to a BG - 11 plate following the same procedure outlined in week 5.
In this lab, you will:
A) Continue segregation for Synechocystis transformants with higher antibiotic, and
B) Transform E. coli with the ligation from last week.
Materials
Ice
Microcentrifuge
Disposable gloves
Competent E. coli cells
Ligation mix
P1000, P200, P20, and disposable tips
0.5 ml microcentrifuge tubes
Electroporation apparatus and cuvettes
YENB medium
LB-agar plates with Ampicillin + X-gal + IPTG
Glass spreader
70% ethanol
3 culture tubes with 1 ml SOC (sterile)
pUC19 (10 pg/µl)
Method: Transformation of E. coli Cells With Week 7 Ligation Mix
1. Refer to transformation/electroporation protocols in week 2.
2. Microcentrifuge the isopropanol precipitated ligation from Week 7 at full speed for 5 min. Orient the hinge of the tube toward the outside of the rotor, so that you can identify the side where the pellet will be.
3. Decant the supernatant to a waste container and invert the tube on a clean paper towel or kimwipe to drain, tapping gently.
4. Wash the pellet. Gently pipet 0.5 ml of 70% ethanol directed to the side of the tube away from the pellet, so that the pellet is not disturbed. Invert the tube once, microfuge for 1 min., and repeat step 3.
5. Dry the pellet in the Speed-vac for 5 min (heat setting low). If you see fluid remaining in the tube, dry for another 5 min. Since ammonium ions are volatile, any residual ammonium ions will evaporate, thus reducing ionic strength for electroporation.
6. Add 4 µl sterile ddH2O and pipet up and down 5 times to resuspend the pellet, and keep on ice.
7. Tubes with 40 µl of E. coli cell suspension suitable for electroporation were prepared by the TAs. Each student will transform his/her ligation mix; and 2 students each will also perform a negative or positive control. Control results will be shared with the entire lab.
8. Label electroporation cuvettes and prechill them by putting them on ice for at least 5-10 minutes.
9. Prewarm tubes with 1 ml of sterile YENB liquid medium in each at 37°C.
10. Label the microcentrifuge tubes containing the 40 µl of E. coli cell suspension. Add 1 µl of ligation mix to tube 1, 1 µl of diluted pUC19 to tube 3 (clean tip, of course), and mix both thoroughly by pipetting the full volume in and out several times. Make sure to use a fresh pipette tip for each sample.
Tube 1 1 µl
ligation mix
Tube 2 Do
not add any DNA- negative control
Tube 3 1 µl
pUC19 (10 pg/µl) - positive control
NOTE: Only 2 students per lab will perform negative or positive controls.
11. Add 2 µl of the appropriate DNA to labeled microcentrifuge tubes with 40 µl E. coli cells and mix thoroughly by gently flicking the tube with your finger 5 times. Avoid pipetting the cells to mix, as cells can be damaged by shearing. Make sure to use a fresh pipette tip for each sample. Incubate the samples on ice for 5 minutes.
12. Carefully (avoid shearing cells!) pipette the contents from one tube into a dry and prechilled electroporation cuvette and tap the bottom gently on the bench top to propel the fluid to the bottom of the cuvette. Put the cuvette back on ice. Make sure that there are no air bubbles in the sample in the cuvette as they may explode upon electroporation!
Do one sample at a time for steps 13-15!!
13. Put the cuvette into the electroporator, pulse at 2.5 kV and record the time constant. Any time constant above 4 ms is OK, while a shorter time constant is indicative of rapid capacitor discharge and therefore high electric current flow that can cause irreversible damage to the cells.
14. Immediately after the pulse, use a P-1000 Pipetman to transfer 1 ml of YENB (prewarmed to 37 °C) medium into the cuvette, and immediately decant into to a glass culture tube, and apply the cap.
15. Place the capped tube in the 37 °C rotary incubator before you start your next electroporation and incubate the tube for 45 minutes.
16. Clearly label the bottom (not the lid) of the LB-Amp-Xgal-IPTG agar plates with a permanent marker. Prepare 2 plates for the ligation transformations.
17. For ligation transformation, gently pipette 0.25 ml cells on one plate, and the remaining volume on the other. For the positive control pUC19, use 0.1 ml. Spread the cells with a sterilized glass spreader. Do the ligation cells first, both plates without sterilizing the glass spreader. Then sterilize the spreader before doing the positive control.
Sterilize the glass spreader by dipping it in 70% ethanol and briefly passing it through a burner flame to ignite the ethanol. Place the 70% ethanol beaker away from the burner so as not to ignite the ethanol in the beaker. Cool the glass spreader for 15 seconds in air, and then placing it on the periphery of the agar plate before spreading the cells. Repeat glass spreader sterilization between samples.
18. Let the cell suspension dry on the plates in the laminar flow hood for 20 minutes and place them inverted in the 37 °C incubator. Colonies should be visible within 14 hours. You will need to come to the lab tomorrow to record your results and to start three 2 ml cultures (LB+50 µg/ml ampicillin), two of which with a white colony coming from the plate with transformants from the ligation mix, and one with a blue colony from the same plate, or if none available, then from the positive control. Cultures are incubated on the rotating wheel at 37 °C. The TA will remove the cultures the next day.
Segregation of Synechocystis transformants: Transfer to higher concentrations of kanamycin
1. Transfer one colony from the plate prepared in week 4 to a BG - 11+glucose+kanamycin (75 µg/ml) plate following the same procedure outlined in week 5.
Prelab Questions
1. Discuss the reason for use of E. coli in this part of the experiment.
2. Discuss the method for selecting transformants.
Weekly Report Update
1. Record your plate results. How many white and blue colonies on your sample and your control?
2. Discuss the Blue/White screen.
One of the most important factors in determining the success or failure of automated sequencing reactions using dideoxy terminators is the quality of the template DNA. To improve the quality of DNA isolated by the miniprep procedure, and to more accurately determine the DNA concentration in the absence of RNA, the miniprep protocol has been modified by addition of reprecipitation step.
Materials
2 ml overnight culture of plasmid-containing E. coli grown in LB + 50 µg/ml
ampicillin
10% SDS
TE solution (10 mM Tris, 1 mM EDTA, pH 8.0)
TER (TE + 15 µg/ml RNase A, DNase-free)
7.5 M ammonium acetate
100% isopropanol
70% ethanol
2 M NaOH
ddH2O
P20, P200, P1000 and pipette tips
1.5 ml microcentrifuge tubes
Ice bucket
Microcentrifuge
Paper towels
Method for plasmid preparation
1. If cells have settled, shake the culture tubes gently to resuspend the E. coli cells.
2. Use a P-1000 to transfer 1.5 ml of each of the 3 cultures into appropriately labeled 1.5 ml microcentrifuge tubes. Use a separate pipet tip for each culture.
3. Close the caps well and centrifuge the tubes for 1 minute in a properly balanced microcentrifuge rotor at ~3/4 speed (~12,000xg). For some microfuges this may be full speed.
4. While cells are spinning, make NS solution (0.5% SDS/0.1 M NaOH) using the 10% SDS and 2 M NaOH stocks (this solution should be made fresh daily):
| Stock | 1 ml | |
| 0.1 N NaOH | 2 M | 0.05 ml |
| 0.5% SDS | 10% | 0.05 ml |
| Water (sterile) | 0.9 ml |
5. Remove the supernatant from the tubes with a P-1000 being careful not to disturb the pellet. Quick-spin 5 sec in the microfuge to pull down residual supernatant, and remove it with another P-1000 tip, being careful not to disturb the pellet.
6. Resuspend each pellet in 50 µl of TE, by gentle digging and stirring with a P-200 pipet tip, followed by moderate vortexing. Be sure to resuspend well, as cells in clumps will not lyse and yield will suffer.
7. Add 300 µl of NS solution to each tube. Mix gently by inverting tubes four times. Do not vortex or mix vigorously because this can cause shearing of the chromosomal DNA, which prevents it from pelleting in the next step.
8. Incubate at room temperature 1-2 min (longer times may cause irreversible denaturation of plasmid.)
9. Add 200 µl of ice-cold 7.5 M ammonium acetate solution to each tube.
Mix by rapidly inverting the tubes several times. A white precipitate will appear
immediately.
NOTE: Ammonium acetate solution is filter sterilized; DO NOT autoclave.
10. Incubate tubes on ice for 5 minutes.
11. Centrifuge for 5 minutes in a balanced microcentrifuge to pellet chromosomal DNA, cell debris, etc.
12. While tubes are spinning, label 3 clean, sterile 1.5 ml tubes and add 0.33 ml isopropanol to each tube.
13. Transfer the supernatants to the tubes containing isopropanol, cap, and vortex to mix well. Avoid taking the pellet and floating debris. Discard old tubes containing precipitate in biohazard waste.
14. Let stand at room temperature for 2 minutes, then centrifuge for 5 minutes in a balanced microcentrifuge at full speed to pellet the nucleic acids. Align the tubes in the rotor so that the cap hinges point outward. Nucleic acid pellets are not always visible, but by orienting the tubes in the rotor in this manner the pellet will form at the bottom of the tube under the hinge during centrifugation.
15. Decant the supernatant to a waste container and invert the tube on a clean paper towel or kimwipe to drain, tapping gently. The pellet should stick firmly, but can be loose. NOTE: Plasmid DNA may be in a pellet at the bottom or streaked on the side of the tube and may be only slightly visible or translucent.
16. Wash the pellet. Gently pipet 0.5 ml of 70% ethanol directed to the side of the tube away from the pellet, so that the pellet is not disturbed. Invert the tube once, observing the pellet to remain attached, and decant the wash to a waste container and invert the tube on a clean paper towel or kimwipe to drain, tapping gently. If you see that the pellet became detached, centrifuge the tube for 1 min at full speed before decanting.
17. Dry the pellet in the Speed-vac for 5 min (heat setting low). If you see fluid remaining in the tube, dry for another 5 min. If not required immediately, pellets can be air-dried on the bench for 15-20 min. Observe closely by holding the tubes up to the light to verify that all fluid is evaporated.
18. Add 30 µl of TER (TE + 15 µg/ml RNase A) to the tube to resuspend the DNA pellet by gently flicking with a finger or vortexing.
19. Incubate the tubes at room temperature for 15 min.
20. To each tube, add:
15 µl 7.5 M ammonium acetate
45 µl isopropanol
Mix well by vortexing or flicking the tube several times.
21. Incubate on ice for 5 minutes, then centrifuge for 5 minutes in a balanced microcentrifuge at full speed to pellet the nucleic acids. Align the tubes in the rotor so that the cap hinges point outward.
22. Repeat steps 15-17.
23. Add 20 µl of sterile ddH2O (NOT TE) to the tube to
resuspend the DNA pellet by gently flicking with a finger or vortexing.
24. Store the DNA at -20 °C until next week.
Prelab Questions
1. Discuss the need for pure DNA for sequence analysis.
Weekly Report Update
1. Discuss the results of gel electrophoresis; include gel photograph.
Segregation of Synechocystis transformants: Transfer to higher concentrations of kanamycin
1. Transfer one colony from the plate prepared in week 4 to a BG - 11+glucose+kanamycin (100 µg/ml) plate following the same procedure outlined in week 5.
Analysis of Recombinant Plasmid by Gel Electrophoresis
Your TA will prepare an agarose gel containing ethidium bromide before lab.
1. Take 2 µl of the prepared plasmid DNA from Week 9 to run gel electrophoresis and place on a parafilm paper.
2. Add 10 µl TE buffer and 2 µl of loading dye, and load the sample.
3. Load 4 µl of 1 kb marker in another well.
4. Electrophorese for 40-50 minutes at 70 volts.
5. Carefully remove the gel and place it in a tray for transport to the AlphaImager.
6. Examine the gel under UV light with the AlphaImager and photograph.
7. Place the remaining DNA sample at -20 °C for automated sequencing. TAs will submit samples showing DNA to the DNA Sequencing Laboratory at ASU.
Wild Type and psbC- Synechocystis Small Scale DNA Preparation
In this lab you will prepare genomic DNA from wild type and psbC- Synechocystis for use in PCR analysis next week.
Materials
Microcentrifuge tubes
7.5 M ammonium acetate (pH = 5.3 )
Microcentrifuge
Bead-Beater
100% ethanol
Glass beads
70% ethanol
TES-equilibrated phenol
TE (10 mM Tris/HCL+0.1 mM EDTA) pH 7.6-7.8
Wild type Synechocystis culture plate
Inoculating loop
psbC- Synechocystis culture plate
Disposable gloves
Chloroform containing 1/25 volume isoamylalcohol
Method
Wild Type and psbC- Synechocystis Small Scale
DNA Preparation
1. Take a thick loop-full from a cyanobacterial plate of wild type and of the psbC- mutant you generated. Resuspend the cells in 200 µl of TE in a 0.5 ml microcentrifuge tube.
2. Add 300 µl of a 1:1 mix of TE:glass beads.
3. Break open the cells with a Bead-Beater for 30 seconds. Use two 0.5 ml microcentrifuge tubes at a time by placing the caps together and position the bottoms in the hole.
4. Have the glass beads settle, remove the aqueous phase (containing the DNA), and place it into a new microcentrifuge tube. Add 100 µl of TE to the glass beads, mix, let the beads settle again, remove the aqueous phase, and combine it with the other aqueous phase. Centrifuge the combined aqueous phases for ten minutes at room temperature. Remove 200-300 µl of the supernatant (containing DNA) to a new microcentrifuge tube.
5. Add 200 µl of TES-equilibrated phenol. Vortex twice for 15 seconds.
6. Centrifuge for five minutes.
7. Remove upper phase to a new tube. Make sure that none of the lower phase is removed, and no mixing occurs.
8. Extract the upper phase with one volume of chloroform to remove traces of phenol.
9. Centrifuge for five minutes.
10. Repeat step 7.
11. Add 1/2 volume of 7.5 M ammonium acetate (pH 5.3), mix, and then add 2.5
volumes of 100% ethanol. Mix by inverting several times. Place samples at -20 °C
until the next lab period.
Prelab Questions
1. Discuss the purpose of glass beads. Compare with E. coli procedures.
A/B) Transform psbC-Synechocystis with recombinant plasmid and wild-type DNA
A) PCR of DNA from wild type and the psbC- transformant of Synechocystis
Materials
Recombinant plasmid
Disposable Gloves
wild type Synechocystis DNA
Primers
psbC-Synechocystis DNA
PCR buffer
BG - 11 medium
Thermo cycler
Microcentrifuge tubes
Taq Polymerase
Inoculating loop
dNTPs
BG - 11 agar
ddH2O
Microcentrifuge
Speed Vac
TE
70% ethanol
Methods
Continue Small Scale DNA Preparation
1. Centrifuge the microcentrifuge tube that was left at -20°C in the last lab period for 5 minutes. Remove the supernatant with a Pipetman being careful not to disturb the pellet. Let the tube sit for a minute and remove more liquid.
2. Wash the pellet with 400 µl of 70% ethanol. Do not resuspend the pellet.
3. Repeat the supernatant removal steps (carefully remove as much of the liquid as possible).
4. Dry the pellet in the Speed Vac for 5-10 minutes.
5. Resuspend the DNA pellet in 20 µl of TE.
Transformation of psbC- Synechocystis with Recombinant Plasmid and Wild Type Genomic DNA
1. The TAs started a liquid culture of psbC- Synechocystis a few days ago. The culture has been spun down shortly before the lab period, and has been resuspended in 1/50 of the original culture volume of BG - 11+ glucose.
2. Transfer 200 µl of this culture into each of four 1.5 ml microcentrifuge tubes.
3. Do not add DNA to one of the tubes, as this will constitute the negative control, but add DNA to the rest of the tubes as indicated below:
Tube number DNA
added
Tube 1 No
DNA
Tube 2 1 µl
Wild type Synechocystis DNA
Tube 3 1 µl
ppsbC recombinant plasmid DNA
Tube 4 1 µl
psbC- Synechocystis
4. Incubate for 30 minutes at room temperature.
5. Plate cells on BG - 11 agar plates.
PCR on Wild Type and psbC- Synechocystis DNA
1. The PCR reaction mix was prepared prior to the lab period by the TAs (the mix contains Taq polymerase, PCR buffer, dNTP, primers, and ddH2O). The primers flank the interruption region of the psbC gene.
2. Transfer 50 µl of PCR mix into two labeled microcentrifuge tubes.
3. Add DNA to the tubes:
Tube
1 Tube 2
PCR mix 50 µl 50 µl
Wild type DNA 1 µ1 ---
psbC- DNA --- 1 µl
4. Set the PCR machine for the following parameters:
1. 94 °C for 3 minutes
2. 94 °C for 1 minute
3. 58 °C for 1 minute
4. 72 °C for 2 minutes
Repeat steps 2-4 30 cycles
4 °C soak cycle
Prelab Questions
1. What do you expect the outcome of the transformation experiment with psbC-Synechocystis to be?
2. Does transformation of psbC-Synechocystis with the recombinant plasmid and the wild type genomic DNA serve the same purpose? Explain.
Weekly Report Update
1. Discuss the purpose and procedure of transformation of psbC-Synechocystis.
2. Discuss what size PCR product(s) you expect to see for wild type and for the psbC mutant.
A) Analysis of PCR products by gel electrophoresis
A/B) Check plates for restored photoautotrophic phenotype by transformation of psbC- mutant
Materials
Agarose
P20, and pipet tips
Electrophoresis apparatus
Week 12 PCR product
6x Loading dye
UV light
1x TAE buffer
1 kb ladder
10 µg/ml ethidium bromide
Methods
Gel electrophoresis on PCR Product
Your TA will prepare an agarose gel containing ethidium bromide before lab.
1. Mix 15 µl of each of the PCR products with 3 µl of loading dye.
2. Load your samples on the gel. Load the 1 kb DNA marker in a separate well next to your sample(s).
3. Run the gel for 40-50 minutes at 70 volts.
4. Carefully remove your gel from the gel electrophoresis box into a tray for transport to the AlphaImager.
5. View under a UV source and photograph your gel.
Checking Plates of psbC- Synechocystis Transformants
1. Record your observations on both genomic DNA and recombinant plasmid transformants. What do you see on the negative control?
Prelab Questions
1. How many and what size bands do you expect to see on the agarose gel for each of the PCR samples?
Weekly Report Update
1. Discuss gel results and include the gel photograph.
2. Discuss your observations regarding the Synechocystis transformants.
Provide a complete summary of the Synechocystis project by addressing the following points:
Provide a complete summary of the Synechocystis project by addressing the following points:
1. What are the features that make Synechocystis sp. PCC 6803 a good model for genetic manipulations?
2. Discuss the procedure for psbC gene manipulation. Outline the purpose of each step and the feature(s) that it demonstrates.
3. Your report should include the data and the gel photographs collected throughout the experiment. Provide a complete analysis of your data.
|
Photosynthesis Center Arizona State University Box 871604 Room PSD 209 Tempe, AZ 85287-1604
23 August 2007 |
phone: (480) 965-1963 fax: (480) 965-2747 |